Skip to content

PCR Amplification

The FoodSeq workflow uses a two-step PCR approach.

A primary qPCR amplifies the target locus from extracted DNA: trnL(UAA)gh for plants and 12SV5 for animals. All amplification primers include Illumina overhang adapter sequences added at the 5' end. Primary qPCR for 12SV5 also includes a human blocking primer. All primary qPCR primers that are used with KAPA HiFi HotStart DNA Polymerase (Roche, Basel, Switzerland) include a phosphorothioate (PS) bond for protection from exonuclease activity.

A secondary PCR adds Illumina adapters and dual 8-bp indices for sample multiplexing.

Primers are custom-synthesized DNA oligos (Integrated DNA Technologies, Coralville, IA) with standard desalting purification.

Table 1. FoodSeq primers. Locus-specific sequences are bolded and Illumina adapters are in standard typeface.

Name Primer sequence 5'–3' Reference
trnL(UAA)g TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGGGCAATCCTGAGCCA*A Taberlet et al., 2007
trnL(UAA)h GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCATTGAGTCTCTGCACCTAT*C
12SV5F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTAGAACAGGCTCCTCTAG Shehzad et al., 2012
12SV5R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTAGATACCCCACTATGC
DeBarba14 HomoB CTATGCTTAGCCCTAAACCTCAACAGTTAAATCAACAAAACTGCT/3SpC3/ De Barba et al., 2014
i7 indexing primer CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTCTCGTGGGCTCGG Illumina, 2025
i5 indexing primer AATGATACGGCGACCACCGAGATCTACACXXXXXXXXTCGTCGGCAGCGTC

XXXXXXXX denotes 8-bp barcode sequences, available from Illumina (Illumina Adapter Sequences).

All PCR setups should be performed in a PCR hood or designated clean area. Clean the work area with surface decontaminant, then treat with UV light for 15 minutes before beginning.

Primary qPCR

Materials

  • KAPA HiFi Hot Start PCR Kit with dNTP Mix (Roche, Basel, Switzerland; Cat. No. KK2502)
  • 10 µM working stock of trnL(UAA)g primer with Illumina bridges (Table 1)
  • 10 µM working stock of trnL(UAA)h primer with Illumina bridges (Table 1)
  • SYBR Green I (Thermo Fisher Scientific, Waltham, MA) — diluted in DMSO to 100X
  • Extracted DNA from stool sample
  • Positive control template DNA
  • Nuclease-free water

Protocol

Generate enough PCR master mix for the reactions desired according to Table 2. The reaction mix and plate must be kept on ice. Aliquot 7 uL of mix into each well.

Add 3 uL of nuclease-free water to no-template control wells (recommendation: 5 wells). Add 3 uL of DNA template to sample wells. Add 3 uL of control DNA to positive control wells (recommendation: 3 wells).

Seal the plate with optical film. Briefly spin down the plate. Run the qPCR with cycling conditions from Table 3.

After the run, transfer plates to -20 °C if processing is going to be paused; otherwise, keep plates at 4 °C. Inspect qPCR curves to confirm amplification and/or run up to 5 uL on an agarose gel or an E-Gel 48 Agarose Gel (Thermo Fisher Scientific, Waltham, MA; Cat. No. G820804) to confirm expected size.

Table 2. Primary qPCR master mix for trnL.

Component 1 rxn (uL) 100 rxns (uL)
Nuclease-free water 3.5 350
10 uM trnL(UAA)g primer 0.5 50
10 uM trnL(UAA)h primer 0.5 50
KAPA HiFi Buffer (5X) 2.0 200
KAPA dNTP Mix (10 mM each) 0.3 30
SYBR Green I (100X) 0.1 10
KAPA HiFi HotStart DNA Polymerase (1 U/uL) 0.1 10
Total 7.0 700

Table 3. Primary qPCR amplification parameters for trnL.

Step Temperature Time Cycles
Initial denaturation 95 °C 3 min 1
Denaturation 98 °C 20 sec 35
Annealing 63 °C 15 sec 35
Extension 72 °C 15 sec 35
Hold 10 °C

Materials

  • AccuStart II PCR SuperMix (Quantabio, Beverly, MA; Cat. No. 95137-500)
  • 10 µM working stock of 12SV5 forward primer with Illumina bridges (Table 1)
  • 10 µM working stock of 12SV5 reverse primer with Illumina bridges (Table 1)
  • SYBR Green I (Thermo Fisher Scientific, Waltham, MA) — diluted in DMSO to 100X
  • Bovine serum albumin (BSA) (Thermo Fisher Scientific, Waltham, MA; Cat. No. B14)
  • Extracted DNA from stool sample
  • Positive control template DNA
  • Nuclease-free water

Protocol

Generate enough PCR master mix for the reactions desired according to Table 4. Aliquot 9 uL of mix into each well.

Add 1 uL of nuclease-free water to no-template control wells (recommendation: 5 wells). Add 1 uL of DNA template to sample wells. Add 1 uL of control DNA to positive control wells (recommendation: 3 wells).

Seal the plate with optical film. Briefly spin down the plate. Run the qPCR with cycling conditions from Table 5.

After the run, transfer plates to -20 °C if processing is going to be paused; otherwise, keep plates at 4 °C. Inspect qPCR curves to confirm amplification and/or run up to 5 uL on an agarose gel or an E-Gel Agarose Gel (Thermo Fisher Scientific, Waltham, MA) to confirm expected size.

Table 4. Primary qPCR master mix for 12SV5.

Component 1 rxn (uL) 100 rxns (uL)
Nuclease-free water 1.65 165
10 uM 12SV5 forward primer 0.5 50
10 uM 12SV5 reverse primer 0.5 50
100 uM DeBarba14 HomoB 1.0 100
AccuStart II PCR SuperMix (2X) 5.0 500
SYBR Green I (100X) 0.1 10
BSA (20 mg/mL) 0.25 25
Total 9.0 900

Table 5. Primary qPCR amplification parameters for 12SV5.

Step Temperature Time Cycles
Initial denaturation 94 °C 3 min 1
Denaturation 94 °C 20 sec 35
Annealing 57 °C 15 sec 35
Extension 72 °C 1 min 35
Hold 10 °C

The multiplex protocol amplifies trnL(UAA)gh and 12SV5 in a single reaction, replacing the two separate singleplex qPCRs above. It uses KAPA HiFi HotStart ReadyMix as the polymerase, includes the DeBarba14 HomoB human blocking primer to suppress amplification of host DNA, and runs for 33 cycles at a 60 °C annealing temperature. Because the polymerase has exonuclease activity, the reaction mix and plate must be kept on ice at all times before cycling begins; otherwise, the exonuclease can degrade the primers prior to the start of the reaction.

Materials

  • KAPA HiFi HotStart ReadyMix (2X) (Roche, Basel, Switzerland; Cat. No. KK2602)
  • 10 µM working stock of trnL(UAA)g primer with Illumina bridges (Table 1)
  • 10 µM working stock of trnL(UAA)h primer with Illumina bridges (Table 1)
  • 10 µM working stock of 12SV5 forward primer with Illumina bridges (Table 1)
  • 10 µM working stock of 12SV5 reverse primer with Illumina bridges (Table 1)
  • 100 µM stock of DeBarba14 HomoB human blocking primer (Table 1)
  • SYBR Green I (Thermo Fisher Scientific, Waltham, MA) — diluted in DMSO to 100X
  • Extracted DNA from stool sample
  • Positive control template DNA — synthetic, or phylogenetically distinct from common foods, containing both plant and animal DNA (or run separate plant and animal positive controls)
  • Nuclease-free water

Protocol

Generate enough PCR master mix for the reactions desired according to Table 6. The reaction mix and plate must be kept on ice. Aliquot 7.5 uL of mix into each well.

Add 2.5 uL of nuclease-free water to no-template control wells. Add 2.5 uL of DNA template to sample wells. Add 2.5 uL of control DNA to positive control wells.

Seal the plate with optical film. Briefly spin down the plate. Run the qPCR with cycling conditions from Table 7.

After the run, transfer plates to -20 °C if processing is going to be paused for more than one day; otherwise, keep plates at 4 °C. Inspect qPCR curves to confirm amplification and/or run 2 uL on an agarose gel or an E-Gel Agarose Gel (Thermo Fisher Scientific, Waltham, MA) to confirm two bands of expected sizes. Once amplification is confirmed, proceed to the indexing qPCR described in the Secondary PCR section below.

Table 6. Primary qPCR master mix for the trnL + 12SV5 multiplex.

Component 1 rxn (uL) 100 rxns (uL)
Nuclease-free water 0.6 60
10 uM trnL(UAA)g primer 0.3 30
10 uM trnL(UAA)h primer 0.3 30
10 uM 12SV5 forward primer 0.3 30
10 uM 12SV5 reverse primer 0.3 30
100 uM DeBarba14 HomoB 0.6 60
KAPA HiFi HotStart ReadyMix (2X) 5.0 500
SYBR Green I (100X) 0.1 10
Total 7.5 750

Table 7. Primary qPCR amplification parameters for the trnL + 12SV5 multiplex.

Step Temperature Time Cycles
Initial denaturation 95 °C 3 min 1
Denaturation 98 °C 20 sec 33
Annealing 60 °C 15 sec 33
Extension 72 °C 15 sec 33
Hold 12 °C

Secondary PCR

Materials

  • KAPA HiFi Hot Start PCR Kit with dNTP Mix (Roche, Basel, Switzerland; Cat. No. KK2502)
  • Pre-mixed Illumina-compatible indexing primers, 2.5 uM each primer, 5 uM total (diluted and mixed in-house; Table 1)
  • Diluted primary PCR amplicons, including any controls
    • Standard dilution is 1:100
    • 1:10 diluted may be used for samples with weak primary amplification such as those from infant cohorts or nutritionally compromised individuals
  • Nuclease-free water

Protocol

Generate enough PCR master mix for the reactions desired according to Table 8. The reaction mix and plate must be kept on ice. Aliquot 35 uL of mix into each well. Add 10 uL of pre-mixed indexing primer to each well.

Add 5 uL of diluted primary PCR products. Seal the plate with optical film. Briefly spin down the plate. Run the PCR with cycling conditions from Table 9.

After the run, transfer plates to -20 °C if processing is going to be paused; otherwise, keep plates at 4 °C. Run up to 5 uL of amplified product on an agarose gel or an E-Gel Agarose Gel (Thermo Fisher Scientific, Waltham, MA) to confirm expected size.

Table 8. Secondary PCR master mix.

Component 1 rxn (uL) 100 rxns (uL)
Nuclease-free water 22.5 2,250
KAPA HiFi Buffer (5X) 10.0 1,000
KAPA dNTP Mix (10 mM each) 1.5 150
SYBR Green I (100X) 0.5 50
KAPA HiFi HotStart DNA Polymerase (1 U/uL) 0.5 50
Total 35.0 3,500

Table 9. Secondary PCR amplification parameters.

Step Temperature Time Cycles
Initial denaturation 95 °C 3 min 1
Denaturation 98 °C 20 sec 10
Annealing 55 °C 15 sec 10
Extension 72 °C 30 sec 10
Hold 10 °C

After PCR amplification, verify your products by Gel Electrophoresis.