Creating the References
These instructions will help you create a trnL or 12Sv5 reference for use in creating phyloseq objects. Where code differs between the two references, largely just due to differences in the naming of variables, content tabs have been used to allow selection of the code for the gene of interest; tabs are linked such that selecting "12Sv5" for one tab will switch all tabs on this page to "12Sv5." A flowchart is provided at the bottom of the page if it may help simplify the workflow of the phyloseq creation process.
Setting Up and Reading in Data
First, load the necessary packages and functions. If you do not have a package installed, install it first with the function install.packages("[package name]"). Make sure to replace the paths to find_primer_pair.R, query_ncbi.R, and query_ncbi_accession.R.
library(Biostrings)
library(here)
library(ShortRead) # for clean()
library(taxonomizr) # for NCBI accession lookup
library(tidyverse)
source('/path/to/code/functions/find_primer_pair.R')
source('/path/to/code/functions/query_ncbi.R')
source('/path/to/code/functions/query_ncbi_accession.R'))
theme_set(theme_bw() +
theme(
axis.text = element_text(size = 12),
axis.title = element_text(size = 14,
face = 'bold'),
legend.title = element_text(size = 12,
face = 'bold'),
strip.text = element_text(size = 12,
face = 'bold')
)
)
Read in primers, food species, and RefSeq data for the gene of interest:
# Primer sequences
trnLG <- DNAString('GGGCAATCCTGAGCCAA')
trnLH <- DNAString('CCATTGAGTCTCTGCACCTATC')
primers <- list(trnLG, trnLH)
# Primer sequences
v5F <- DNAString('TAGAACAGGCTCCTCTAG')
v5R <- DNAString('TTAGATACCCCACTATGC')
primers <- list(v5F, v5R)
Note
Variables in R cannot begin with a number, so instead of 12Sv5F and 12Sv5R we are using v5F and v5R.
Also, read in the SQL file (see Creating the SQL File for more information):
Querying for Sequences
With everything read in, we now need to determine the sequences from both RefSeq (saved locally) and the NCBI that belong to food species and have the gene of interest as determined by our primers.
RefSeq
First, clean the RefSeq sequences and determine which sequences have the primer pair:
refseq.trnL <- find_primer_pair(plastid,
fwd = primers[[1]],
rev = primers[[2]])
cat(length(refseq.trnL), 'sequences have the primer set')
Next, subset the sequences to our list of food species and keep the accessions:
First, clean the RefSeq sequences and determine which sequences have the primer pair:
refseq.12SV5 <- find_primer_pair(mito,
fwd = primers[[1]],
rev = primers[[2]])
cat(length(refseq.12SV5), 'sequences have the primer set')
Next, subset the sequences to our list of food species and keep the accessions:
# Find indices of entries matching
animals.i <-
lapply(animals, grep, x = names(refseq.12SV5)) %>%
unlist()
cat('There are', length(animals), 'food animals in our query\n')
# Subset
refseq.12SV5 <- refseq.12SV5[animals.i]
cat(length(refseq.12SV5), 'have a 12SV5 sequence in the RefSeq mito database')
NCBI
Tip
The NCBI query may prove tedious, especially for 12Sv5; for best results:
- Set an API key. Create an NCBI account (you can log in with Google) and go to NCBI Account Settings. At the bottom of the page, under "API Key Management," you should find an alphanumeric API key. Copy this, and in R, run
set_entrez_key("1a2b3c")with your API key pasted in. This increases your e-utils limit to 10 requests per second. - Run the following code either on weekends or between 9:00 PM and 5:00 AM EST on weekdays.
- Other usage guidelines and requirements can be found at this link.
Use the custom query_ncbi() function to query the NCBI for trnL sequences from food species:
Determine which sequences have the primer pair:
ncbi.trnL <- find_primer_pair(ncbi.trnL,
fwd = primers[[1]],
rev = primers[[2]])
cat(length(ncbi.trnL), 'sequences have the primer set')
Remove unverified entries:
# Note some entries are marked as unverified
names(ncbi.trnL)[grepl('UNVERIFIED', names(ncbi.trnL))] |>
head(5)
# Remove
length(ncbi.trnL)
ncbi.trnL <- ncbi.trnL[!(grepl('UNVERIFIED', names(ncbi.trnL)))]
length(ncbi.trnL)
And last, strip the names to just their accessions:
Use the custom query_ncbi() function to query the NCBI for 12Sv5 sequences from food species:
Determine which sequences have the primer pair:
ncbi.12SV5 <- find_primer_pair(ncbi.12SV5,
fwd = primers[[1]],
rev = primers[[2]])
cat(length(ncbi.12SV5), 'sequences have the primer set')
Remove unverified entries:
# Note some entries are marked as unverified
names(ncbi.12SV5)[grepl('UNVERIFIED', names(ncbi.12SV5))] |>
head(5)
# Remove
length(ncbi.12SV5)
ncbi.12SV5 <- ncbi.12SV5[!(grepl('UNVERIFIED', names(ncbi.12SV5)))]
length(ncbi.12SV5)
And last, strip the names to just their accessions:
Combining RefSeq and NCBI Output
We can now merge the output of the above queries.
First, let's check the degree of overlap:
# Named as accession numbers:
intersect(names(ncbi.trnL), names(refseq.trnL)) |> length()
setdiff(names(refseq.trnL), names(ncbi.trnL)) |> length()
setdiff(names(ncbi.trnL), names(refseq.trnL)) |> length()
Note
Theoretically, RefSeq should be entirely contained within NCBI's nucleotide record, but the above output will show that there are entries unique to RefSeq in our output. This may be because we restrict the NCBI query to entries containing the term "trnL" in order to keep the output manageable; this can be an area for future updates.
We can now merge:
# Data frame of results
seqs.df <-
data.frame(source = 'RefSeq',
accession = names(refseq.trnL),
seq = as.character(refseq.trnL))
seqs.df <-
data.frame(source = 'GenBank',
accession = names(ncbi.trnL),
seq = as.character(ncbi.trnL)) |>
bind_rows(seqs.df)
head(seqs.df)
For trnL only, manual additions must be added in as well:
# Note that these don't have primers currently
# To get the most accurate sequence, let's just pull these records from NCBI by their accession number and trim directly
# Note some of these returned sequences are whole genomes-- takes a few mins.
seqs <-
entrez_fetch(db='nucleotide',
id = additions$accession,
rettype='fasta') %>%
# This returns concatenated sequence strings; split apart
# so we can re-name inline
strsplit('\n{2,}') %>% # Usually two newline chars, but sometimes more
unlist()
# Save this to ultimately combine with taxonomy data, as want to
# be able to identify these sequences after the fact
ex <- '[^>]\\S*'
accs <- str_extract(seqs, ex)
# Keep full header for descriptive name
headers <- str_extract(seqs, '^[^\n]*')
seqs <-
seqs %>%
# Now update seqs to sequence only, stripping header
sub('^[^\n]*\n', '', .) %>%
# And removing separating \n characters
gsub('\n', '', .)
# Now add to DNAStringSet
seqs <- DNAStringSet(seqs)
names(seqs) <- accs
seqs <- find_primer_pair(seqs,
fwd = primers[[1]],
rev = primers[[2]])
First, let's check the degree of overlap:
# Named as accession numbers:
intersect(names(ncbi.12SV5), names(refseq.12SV5)) |> length()
setdiff(names(refseq.12SV5), names(ncbi.12SV5)) |> length()
setdiff(names(ncbi.12SV5), names(refseq.12SV5)) |> length()
Note
Theoretically, RefSeq should be entirely contained within NCBI's nucleotide record, but the above output will show that there are entries unique to RefSeq in our output. This may be because we restrict the NCBI query to entries containing the term "trnL" in order to keep the output manageable; this can be an area for future updates.
We can now merge:
Adding Taxonomy
Now, let's use the SQL file to connect accessions to taxon IDs:
# Look up accession taxonomy using taxonomizr-formatted SQL database
ids <- taxonomizr::accessionToTaxa(seqs.df$accession, sql)
The following code chunks determine if there are names missing and fill them in:
Missing entries are sequence records that have been added to NCBI in the time between making the SQL file and now. Using the query_ncbi_accession() function, iterate through missing.df and add these records in:
for(i in seq_len(nrow(missing.df))) {
idx <- rownames(missing.df)[i]
idx <- as.integer(idx)
acc <- missing.df[i,2]
ids[idx] <- query_ncbi_accession(acc)
}
# Confirm got them all
any(is.na(ids))
Using the taxonomizr package, we can now get taxonomic information from the taxon IDs:
We can reformat this output to suit our needs by selecting the ranks we're interested in and adding taxon IDs for joining back to accessions:
# Pull desired levels from this structure
# Not working within getTaxonomy function
vars <- c("superkingdom",
"phylum",
"class",
"order",
"family",
"genus",
"species",
"subspecies")
taxonomy <- data.frame(superkingdom = NULL,
phylum = NULL,
class = NULL,
order = NULL,
family = NULL,
genus = NULL,
species = NULL,
subspecies = NULL)
for (i in seq_along(taxonomy.raw)){
row.i <-
taxonomy.raw[[i]] |>
t() |>
data.frame()
# Pick columns we're interested in
shared <- intersect(vars, names(row.i))
row.i <- select(row.i, one_of(shared))
taxonomy <- bind_rows(taxonomy, row.i)
}
# Add taxon ID
taxonomy$taxid <-
names(taxonomy.raw) |>
trimws() |>
as.integer()
taxonomy <- select(taxonomy, taxid, everything())
Now join taxonomy back to seqs.df:
Now get the lowest-level taxon name and filter seqs.df for the desired columns:
# Get lowest-level taxon name
seqs.df <-
seqs.df |>
MButils::lowest_level() |>
rename(taxon = 'name') |>
select(source, accession, taxon, taxid, superkingdom:subspecies, seq)
Manual Updates (trnL only)
For trnL only, we must manually rename and omit certain foods; this is done with the edits CSV read in earlier, which has a column type corresponding to the necessary change (foods whose type is add were added when we merged the RefSeq and NCBI outputs). First we can omit the foods whose type is omit:
# Handle omissions
omit <- filter(edits, type=='omit')
seqs.df <-
filter(seqs.df,
!(accession %in% omit$accession & seq %in% omit$sequence))
Next we rename the foods whose type is rename:
# Handle renaming
name.update <- filter(edits, type=='rename')
filter(seqs.df,
accession %in% name.update$accession)
The following manual changes are to varietates of Brassica oleracea in seqs.df:
# Note that original sequence 'AC183493.1' not found, leaving off for now
# Will need to generalize this later, but now can just update specifically
seqs.df$varietas[seqs.df$accession == 'AB213010.1'] <- 'Brassica oleracea var. capitata'
seqs.df$varietas[seqs.df$accession == 'AC183493.1'] <- 'Brassica oleracea var. alboglabra'
seqs.df$varietas[seqs.df$accession == 'LR031874.1'] <- 'Brassica oleracea var. italica'
seqs.df$varietas[seqs.df$accession == 'LR031875.1'] <- 'Brassica oleracea var. italica'
seqs.df$varietas[seqs.df$accession == 'LR031876.1'] <- 'Brassica oleracea var. italica'
# Get lowest-level taxon name
seqs.df <-
seqs.df |>
MButils::lowest_level() |>
rename(taxon = 'name') |>
select(source, accession, taxon, taxid, superkingdom:forma, seq)
Quality Control, Sequence Alignment, and Cleaning
We can now do some quality control on seqs.df. Let's first check for nucleotide degeneracy (any codes that are not A, C, G, or T) and determine if there are "back-up" sequences to allow for removing degenerate sequences:
# Add a flag to these taxa, to see if there's a back-up sequence
seqs.df$N <- grepl('[AGCT]*[^AGCT]+', seqs.df$seq)
with_n <-
seqs.df$taxon[grepl('[AGCT]*[^AGCT]+', seqs.df$seq)] |>
unique()
seqs.df |>
filter(taxon %in% with_n) |>
group_by(taxon, N) |>
count() |>
ungroup() |>
group_by(taxon) |>
summarize(any(!N)) |>
arrange(`any(!N)`)
# Remove sequences containing Ns
seqs.df <-
filter(seqs.df,
!grepl(pattern = '[AGCT]*[^AGCT]+', seq))
Now, let's align sequence orientations.
The following code sets maximum allowed mismatch thresholds as 20% of the lengths of the forward and reverse primers:
# Get orientation of sequence by finding primers
# How many mismatches are allowed?
fwd_err <- floor(0.2*length(trnLG))
rev_err <- floor(0.2*length(trnLH))
fwd_err
rev_err
Now, we feed the sequences from seqs.df into a DNAStringSet object:
The following code finds forward and reverse primer matches, combines them back into seqs.df, and checks that no sequences were lost:
# Forward primer at start of read
fwd_matches <-
vmatchPattern(trnLG,
ref,
max.mismatch = fwd_err,
fixed = TRUE) |>
as.data.frame() |>
filter(start <= 1) |>
mutate(type = 'forward') |>
select(group, type)
# Reverse primer at start of read
rev_matches <-
vmatchPattern(trnLH,
ref,
max.mismatch = rev_err,
fixed = TRUE) |>
as.data.frame() |>
filter(start <= 1) |>
mutate(type = 'reverse') |>
select(group, type)
seqs.df <-
bind_rows(fwd_matches,
rev_matches) |>
arrange(group) |>
bind_cols(seqs.df)
seqs.df |>
group_by(type) |>
count()
This code now corrects reverse-oriented sequences with the reverseComplement() function:
The following code sets maximum allowed mismatch thresholds as 20% of the lengths of the forward and reverse primers:
# Get orientation of sequence by finding primers
# How many mismatches are allowed?
fwd_err <- floor(0.2*length(v5F))
rev_err <- floor(0.2*length(v5R))
fwd_err
rev_err
Now, we feed the sequences from seqs.df into a DNAStringSet object:
The following code finds forward and reverse primer matches, combines them back into seqs.df, and checks that no sequences were lost:
# Forward primer at start of read
fwd_matches <-
vmatchPattern(v5F,
ref,
max.mismatch = fwd_err,
fixed = TRUE) |>
as.data.frame() |>
filter(start <= 1) |>
mutate(type = 'forward') |>
select(group, type)
# Reverse primer at start of read
rev_matches <-
vmatchPattern(v5R,
ref,
max.mismatch = rev_err,
fixed = TRUE) |>
as.data.frame() |>
filter(start <= 1) |>
mutate(type = 'reverse') |>
select(group, type)
seqs.df <-
bind_rows(fwd_matches,
rev_matches) |>
arrange(group) |>
bind_cols(seqs.df)
seqs.df |>
group_by(type) |>
count()
This code now corrects reverse-oriented sequences with the reverseComplement() function:
The last step is now removing redundant sequences which are the same and come from the same species:
How many duplicates are there?
The number of sequences we expect after filtering is given by:
This now groups identical entries, choosing the first accession number which is from RefSeq if possible, effectively removing duplicates:
seqs.df <-
seqs.df |>
group_by(superkingdom,
phylum,
class,
order,
family,
genus,
species,
subspecies,
taxon,
seq) |>
arrange(desc(source), accession) |> # Puts RefSeq accessions first
summarize(accession = first(accession)) # Choose the first accession number
dim(seqs.df)
Adding Human Sequences to the 12Sv5 Reference
The NCBI contains only a single Homo sapiens reference sequence for the 12Sv5 region, which is insufficient for accurately assigning all human ASVs in our data due to natural genetic diversity across individuals. To address this, we supplement the 12Sv5 reference with human sequences from Schneider et al. (2021), who compiled a 12S reference from the European Nucleotide Archive (ENA) for forensic dietary analysis and included substantially more Homo sapiens sequence variants.
After building the 12Sv5 reference with the steps above, add the human sequences from the Schneider reference by extracting all Homo sapiens entries and appending them to seqs.df. These sequences should go through the same quality control and deduplication steps described in the previous section.
Note
Schneider J, Mas-Carrió E, Jan C, Miquel C, Taberlet P, Michaud K, Fumagalli L, Comprehensive coverage of human last meal components revealed by a forensic DNA metabarcoding approach. Sci. Rep. 11, 8876 (2021). https://doi.org/10.1038/s41598-021-88418-x
Saving the References
To-do
Finish the following sections.